sequence - R: How to use output of 'translate' function to write a table? -

-

i have file (data.txt) contains 2 dna sequences (orf):

data = readdnastringset(file="data.txt")  data # dnastringset instance of length 2 # width seq                                                       names #[1]  57 atgacccccacctccatccccacacttctatcccgctgccccgcctctctcccctaa  gpg #[2]  54 atgacccatgagcaccatgcagccaaaaccctgggaatcggcaaagccatctag     pfk

i want convert them aminoacids: 

t=vector(mode="list", length=length(data)) (i in seq_along(data)) { t[[i]]=translate(data[[i]]) } t #[[1]] #19-letter "aastring" instance #seq: mtptsiptllsrcpaslp*  #[[2]] #18-letter "aastring" instance #seq: mthehhaaktlgigkai*

then write table , have output using:

tt=do.call(rbind,t) write.table(tt,"aa.txt",sep="\t\t")

but these commands don't work. couldn't find problem. how can write table?

note: translate function [seqinr] , readdnastringset function [biostrings].

i don't know why need seqinr. biostrings need.

library("biostrings")  dna <- readdnastringset(file="data.txt") aa <- translate(dna)  write.table(as.character(aa), file="aa.txt", sep="\t\t")

maybe want use writexstringset instead of write.table.


Comments

Post a Comment

Popular posts from this blog

c++ - Creating new partition disk winapi -

-
i'am trying create new partition , mount volume new, thought createfile let me this, code : lpctstr lpfilename=l"\\\\.\\device\\harddisk0\\partition3"; handle handl=createfile( lpfilename, generic_read | generic_write, file_share_read | file_share_write, null, create_always, file_attribute_normal, null ); if (handl==invalid_handle_value) { qdebug()<<"handl invalid"<<" error"<<getlasterror();} bool success = definedosdevice(ddd_raw_target_path,l"i:",l"\\device\\harddisk0\\partition3"); if(!success) qdebug()<<" definedosdevice failed "<<getlasterror(); bflag = getvolumenameforvolumemountpoint( l"i:\\", // input volume mount point or directory /** u in dir
Read more

Android Prevent Bluetooth Pairing Dialog -

-
i'm developing internal application uses bluetooth printing. want bluetooth pairing occur without user input. have managed working trapping android.bluetooth.device.action.pairing_request broadcast. in broadcast receiver call setpin method, , pairing works ok, bluetoothpairingdialog displayed second or two, disappears - see link below. https://github.com/android/platform_packages_apps_settings/blob/master/src/com/android/settings/bluetooth/bluetoothpairingdialog.java since broadcast non-ordered, can't call abortbroadcast() , , wondering if there other way prevent pairing dialog appearing. can hook window manager in way? i haven't been able come way without modifying sdk. if you're oem, it's easy (i'm on 4.3): in packages/apps/settings/androidmanifest.xml, comment intent filter pairing dialog: <activity android:name=".bluetooth.bluetoothpairingdialog" android:label="@string/bluetooth_pairing_request"
Read more

VBA function to include CDATA -

-
i have following function include cdata: function cdatasection() dim objdom domdocument dim objkmlrootelement ikmldomelement dim objkmlelement ikmldomelement dim cdata ikmldomcdatasection set objdom = new domdocument set objkmlrootelement = objdom.createelement("balloonstyle") objdom.appendchild objkmlrootelement set objkmlelement = objdom.createelement("text") objkmlrootelement.appendchild objkmlelement set cdata = objdom.createcdatasection("text") cdata.data = "<![cdata[<b>latitude = $[latitude]</b>?]]>;" end function when run above, getting error "user defined data type not found" function. yes ripster says find library reference. vba window tools>references for list of relevant references see... http://msdn.microsoft.com/en-us/library/windows/desktop/ms763701%28v=vs.85%29.aspx however, if have hard time tracking down reference, replace dim sta
Read more